Palindrome sequences


Instruction
  1. Input a sequence in the following format
    
    	TGGAACTTTCAGTAATACGCTTAACTGCTCATTGCTATATTGAAGTACGG
    	ATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTCC
    	GTGCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCG
    	CGCCGCACTGCTCCGAACAATAAAGATTCTACAATACTAGCTTTTATGGT
    	TATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTA
    	ACGAATCAAATTAACAACCATAGGATGATAATGCGATTAGTTTTTTAGCC
    	TTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAAC
    	AGATATATAAATGGAAAAGCTGCATAACCACTTTAACTAATACTTTCAAC
    	ATTTTCAGTTTGTATTACTTCTTATTCAAATGTCATAAAAGTATCAACAA
    	AAAATTGTTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAACTATA
    	ATGACTAAATCTCATTCAGAAGAAGTGATTGTACCTGAGTTCAATTCTAG
    
    
  2. Operations in the "File" menu