Transcriptional Regulatory Element Database

HOME
Database Statistics
Browse Database
Retrieve Promoters
Search TF Target Genes
Retrieve TF Motifs
Gene Regulatory Networks
Search Orthologs
Sequence Analysis Tools
Useful Links

Promoter Information


Accession Number 35315
Gene BRD2
Species human, Homo sapiens
Chromosome 6
Strand +
Transcription Start Site 32937918
Quality 3.1: refseq,predicted - associated with Refseq, TSS is predicted
References
  • [1] GenBank Nucleotide: NM_005104
    Homo sapiens bromodomain containing 2 (BRD2), mRNA.
Sequence
ACGGTCCACTACGAAATAAATAGAGAAGGAAAAGTTATCAGCTGGTAAAT    -651
ATCGTAGAAGGTAGAGCGGTCCAGGGACTCACAGGTCTCACTAAAGAAAA    -601
GTCTAGCGTAGGTTCACGGCACGGAGAGATTTTAAGGCTGCCTAAGACTA    -551
AAGCCAAATACGAAGTCCACATCTGCGGTCCGCACCTTATCTCTCCGCGC    -501
GGCAGGCGCGACGAGGGCGAGAAACTCCCTCTCCAGTGGTCGCACCACAC    -451
GACACCAGGGAAGGGGCCCCTCTCTCCAGACCCTCATATCTCCAGGTCCA    -401
GGCCCCATTTTCCTCCGCTGACAGCTCAGCAGCGTGCGCTTCCGCTGGAT    -351
TCAGGCCAGGACCAGCGAAGCCGCACCTTACACCCACCGAGGAGGAAACA    -301
AGCCTGGCCACCCGAGGCTACCCCGCTAGGCCGCGGGTAGTGGGGGAGGG    -251
GGCGCTGAGGCAGGAGGTCAGCACCCGGGCGCGGGCTCCCGCCCCACGAA    -201
ATGCGCGCGCTCCAAGCCCCGCCGCCGGAGATGCGGTTCCGGTCCGGACG    -151
CCTGCGCACTACGGCTCTCCCCGCAGCCTCTGGCCCTCCTTCCCCCTCCC    -101
CCAGTCAGGGCGCACCCTTGCGCCTGCGCTGTGTGTGTTCCTGGTCTGCG     -51
GCAGCCATGCTGAACTCGTATGGAGAGGCGAGTGGGGGGGACAGAGTCCA      -1
GGACTGCGGGATAGGAAGCTGGGGATATGGACAAGCAGCAGCGTTATAGC      49
GCTCTGGGTTTCGGGACATAGGCCTGGGCCATGCGGCCCCCTTGGCCCCT      99
TGGCGCGACCCCCAGGAACGTTCGGAAAGCTGGTCCTCGTGGCTGGGGGA     149
AAGGCGGGGGGTGGGGGGGAAGCGGGCACGTGACCCCGGTCAGCCAATCT     199
GGGTGCTGCTGACGTACGCGCGCGGCCCCGATGCTCTCCCCACCCCCCCA     249
GCCCGTTCGGGAAGGGAGGGGCTGGGGGCTACGCCCCATCCCCCAGCACG     299
Display Sequence From To
relative to transcription start site.
Analyze Sequence:
Retrieve Above Sequence
View on UCSC Genome Browser for :
Michael Zhang Lab, Cold Spring Harbor Laboratory, all rights reserved
Questions/suggestions email: