List of Splicing Enhancers (980418)

1location
2gene
3GenBank number (gi or accession)
4size
5sequence
6binding factor(s)
7experiments
8citation
9medline number
10comments

1EDA exon
2human fibronectin
3ID g31402
48 nt
5gaagaaga
6unknown
7the RT-PCR analysis of the RNA from the extracts prepared from HeLa cells transiently transfected with the reportergenes
8Caputi M, Casari G, Guenzi S, Tagliabue R, Sidoli A, Melo CA, Baralle FE. A novel bipartite splicing enhancer modulates the differential processing of the human fibronectin EDA exon. Nucleic Acids Res. 1994 Mar 25; 22(6): 1018-1022.
9PMID: 8152907; UID: 94203784.
10this sequence (element A) lies within a 81 nt bipartite splicing enhancer of EDA exon, that is essential for differential RNA processing; element A is a positive modulator for recognition of the exon, its deletion results in constitutive exclusion of the EDA exon. Element B is a negative modulator for exon recognition, and its deletion results in constitutive inclusion of the EDA exon.

1exon M2
2mouse immunoglobulin m gene (IgM)
3ID gi202416
423 nt
5ggaaggacagcagagaccaagag
6unknown
7the in vitro splicing system with HeLa cell nuclear extracts and dsx chimeric pre-mRNA
8Tanaka K, Watakabe A, Shimura Y. Polypurine sequences within a downstream exon function as a splicing enhancer. Mol Cell Biol. 1994 Feb; 14(2): 1347-1354.
9PMID: 8289812; UID: 94119085.
10none

1intron downstream of microexon 17
2chicken cardiac troponin T
3ID gi1839454
4146 nt
5gtaagt caggctgcat gcctcccacc acacctgtgc tgcatgacac ctggggctga cctgcaacag aagtggggct gagggaagga ctgtcctggg gactggtgtc agagcggggt tggtgactct caggatgccc aaaatgccca (conserved heptamer sequences are underlined)
6unknown
7the RT-PCR analysis of the RNA from the extracts prepared from cells transiently transfected with the reportergenes
8Carlo,T., Sterner,D.A. and Berget,S.M. An intron splicing enhancer containing a G-rich repeat facilitates inclusion of a vertebrate micro-exon. RNA 2 (4), 342-353 (1996)
9UID: 96211457
10none

1exon 5
2avian cardiac troponin T (cTNT)
3ID gi212783
4<30 nt
5aagaggaagaatggcttgaggaagacgacg
6SRp55
7gel mobility retardation experiments/ mutation analysis
8Nagel RJ, Lancaster AM, Zahler AM. Specific binding of an exonic splicing enhancer by the pre-mRNA splicing factor SRp55. RNA 1998 Jan;4(1):11-23
9PMID: 9436904, UID: 98097404
10none

1exon 4
2Drosophila dsx
3ID g7882
46x13 nt
5(tc(t/a)(t/a)c(a/g)atcaaca
6tra/tra2/others
7in vitro trans-splicing assay
8Bruzik JP, Maniatis T. Enhancer-dependent interaction between 5' and 3' splice sites in trans. Proc Natl Acad Sci U S A. 1995 Jul 18; 92(15):7056-7059.
9PMID: 7624368; UID: 95350210.
10none

1intron B downstream of exon N1(neuron-specific) and upstream of exon 4
2mouse c-src
3ID gi192829
432 nt
5aggctgggggctgctctctgcatgtgcttcct (downstream control sequence,DCS)
6p75/KSRP, p90, p58, p43, p28 (Min et al., 1997) ;; p53/hnRNP F (Min et al., 1995)
7gel mobility shift assay/RNA affinity column (Min et al., 1997) ;; UV-cross-linking experiments/gel mobility shift/in vitro splicing (Min et al., 1995)
8Min H, Turck CW, Nikolic JM, Black DL. A new regulatory protein, KSRP, mediates exon inclusion through an intronic splicing enhancer. Genes Dev. 1997 Apr 15; 11(8): 1023-1036. ;; Min H,Min H, Chan RC, Black DL. The generally expressed hnRNP F is involved in a neural-specific pre-mRNA splicing event. Genes Dev. 1995 Nov 1; 9(21): 2659-2671.
9PMID: 9136930; UID: 97282621. (Min et al., 1997) ;; PMID: 7590243; UID: 96067158. (Min et al., 1995)
10hnRNP binds tightly to the c-src pre-mRNA only in the neuronal extracts.

1alternative exon 5/SK (expressed specifically in skeletal muscles)
2human a-tropomyosin gene
3ID g37429
4not determined
5taagtgttctgagctggaggaggagctgaagaatgtcaccaacaacctcaagtctcttgaggctcaggcggagaag (exon SK)
6unknown
7analysis of a minigenes in transient transfections by RT-PCR and S1 mapping.
8Graham IR, Hamshere M, Eperon IC. Alternative splicing of a human alpha-tropomyosin muscle-specific exon: identification of determining sequences. Mol Cell Biol. 1992 Sep; 12(9): 3872-3882.
9PMID: 1508190; UID: 92375055.
10acting mechanism is not clarified; it seems most likely that the exon sequence is a target for the action of repressor proteins in nonmuscle cells.

1artificial
2artificial
3no
427 nt (pH23 sequence)
5gaattcctcgacattgggagcagtcggctcgtgctcgacattgggagcagtcggctcgtgc-tcgacattgggagcagtcggctcgtgctcgagtctaga (B3 sequence)
6SRp40
7SELEX (=systematic evolution of ligands by expontential enrichment)/ in vitro splicing assay.
8Tacke R, Manley, J. Sequence-specific RNA binding by an SR protein requires RS domain phosphorylation: creation of an SRp40-specific splicing enhancer. Proc Natl Acad Sci U S A. 1997 Feb 18; 94(4): 1148-1153.
9PMID: 9037021; UID: 97188436.
10B3 sequence used for minigene construction, contain 3 repeats of pH23; (tcgacattgggagcagtcggctcgtgc-pH23 selected by SELEX as high affinity binding site for phosphorylated HSRp40. Unphosphorylated SRp40 failed to select specific sequences.

1exon 3
2tat-rev gene of HIV-1
3ID gi1145660
430 nt
5gaagaagaaggtggagagagagagacagag
6unknown
7analysis of splicesome complex formation/ analysis of in vitro splicing of HIV-1 minigene substrates.
8Amendt BA, Si ZH, Stoltzfus CM. Presence of exon splicing silencers within human immunodeficiency virus type 1 tat exon 2 and tat-rev exon 3: evidence for inhibition mediated by cellular factors. Mol Cell Biol. 1995 Nov; 15(11): 6480.
9PMID: 7565800; UID: 96026028.
10the same exon contains a splicing silencer


Last update: 18 April, 1998
nakai@imcb.osaka-u.ac.jp