List of Splicing Enhancers (980418)

1	location
2	gene
3	GenBank number (gi or accession)
4	size
5	sequence
6	binding factor(s)
7	experiments
8	citation
9	medline number
10	comments

1	EDA exon
2	human fibronectin
3	ID g31402
4	8 nt
5	gaagaaga
6	unknown
7	the RT-PCR analysis of the RNA from the extracts prepared from HeLa cells transiently transfected with the reportergenes
8	Caputi M, Casari G, Guenzi S, Tagliabue R, Sidoli A, Melo CA, Baralle FE. A novel bipartite splicing enhancer modulates the differential processing of the human fibronectin EDA exon. Nucleic Acids Res. 1994 Mar 25; 22(6): 1018-1022.
9	PMID: 8152907; UID: 94203784.
10	this sequence (element A) lies within a 81 nt bipartite splicing enhancer of EDA exon, that is essential for differential RNA processing; element A is a positive modulator for recognition of the exon, its deletion results in constitutive exclusion of the EDA exon. Element B is a negative modulator for exon recognition, and its deletion results in constitutive inclusion of the EDA exon.

1	exon M2
2	mouse immunoglobulin m gene (IgM)
3	ID gi202416
4	23 nt
5	ggaaggacagcagagaccaagag
6	unknown
7	the in vitro splicing system with HeLa cell nuclear extracts and dsx chimeric pre-mRNA
8	Tanaka K, Watakabe A, Shimura Y. Polypurine sequences within a downstream exon function as a splicing enhancer. Mol Cell Biol. 1994 Feb; 14(2): 1347-1354.
9	PMID: 8289812; UID: 94119085.
10	none

1	intron downstream of microexon 17
2	chicken cardiac troponin T
3	ID gi1839454
4	146 nt
5	gtaagt caggctgcat gcctcccacc acacctgtgc tgcatgacac ctggggctga cctgcaacag aagtggggct gagggaagga ctgtcctggg gactggtgtc agagcggggt tggtgactct caggatgccc aaaatgccca (conserved heptamer sequences are underlined)
6	unknown
7	the RT-PCR analysis of the RNA from the extracts prepared from cells transiently transfected with the reportergenes
8	Carlo,T., Sterner,D.A. and Berget,S.M. An intron splicing enhancer containing a G-rich repeat facilitates inclusion of a vertebrate micro-exon. RNA 2 (4), 342-353 (1996)
9	UID: 96211457
10	none

1	exon 5
2	avian cardiac troponin T (cTNT)
3	ID gi212783
4	<30 nt
5	aagaggaagaatggcttgaggaagacgacg
6	SRp55
7	gel mobility retardation experiments/ mutation analysis
8	Nagel RJ, Lancaster AM, Zahler AM. Specific binding of an exonic splicing enhancer by the pre-mRNA splicing factor SRp55. RNA 1998 Jan;4(1):11-23
9	PMID: 9436904, UID: 98097404
10	none

1	exon 4
2	Drosophila dsx
3	ID g7882
4	6x13 nt
5	(tc(t/a)(t/a)c(a/g)atcaaca
6	tra/tra2/others
7	in vitro trans-splicing assay
8	Bruzik JP, Maniatis T. Enhancer-dependent interaction between 5' and 3' splice sites in trans. Proc Natl Acad Sci U S A. 1995 Jul 18; 92(15):7056-7059.
9	PMID: 7624368; UID: 95350210.
10	none

1	intron B downstream of exon N1(neuron-specific) and upstream of exon 4
2	mouse c-src
3	ID gi192829
4	32 nt
5	aggctgggggctgctctctgcatgtgcttcct (downstream control sequence,DCS)
6	p75/KSRP, p90, p58, p43, p28 (Min et al., 1997) ;; p53/hnRNP F (Min et al., 1995)
7	gel mobility shift assay/RNA affinity column (Min et al., 1997) ;; UV-cross-linking experiments/gel mobility shift/in vitro splicing (Min et al., 1995)
8	Min H, Turck CW, Nikolic JM, Black DL. A new regulatory protein, KSRP, mediates exon inclusion through an intronic splicing enhancer. Genes Dev. 1997 Apr 15; 11(8): 1023-1036. ;; Min H,Min H, Chan RC, Black DL. The generally expressed hnRNP F is involved in a neural-specific pre-mRNA splicing event. Genes Dev. 1995 Nov 1; 9(21): 2659-2671.
9	PMID: 9136930; UID: 97282621. (Min et al., 1997) ;; PMID: 7590243; UID: 96067158. (Min et al., 1995)
10	hnRNP binds tightly to the c-src pre-mRNA only in the neuronal extracts.

1	alternative exon 5/SK (expressed specifically in skeletal muscles)
2	human a-tropomyosin gene
3	ID g37429
4	not determined
5	taagtgttctgagctggaggaggagctgaagaatgtcaccaacaacctcaagtctcttgaggctcaggcggagaag (exon SK)
6	unknown
7	analysis of a minigenes in transient transfections by RT-PCR and S1 mapping.
8	Graham IR, Hamshere M, Eperon IC. Alternative splicing of a human alpha-tropomyosin muscle-specific exon: identification of determining sequences. Mol Cell Biol. 1992 Sep; 12(9): 3872-3882.
9	PMID: 1508190; UID: 92375055.
10	acting mechanism is not clarified; it seems most likely that the exon sequence is a target for the action of repressor proteins in nonmuscle cells.

1	artificial
2	artificial
3	no
4	27 nt (pH23 sequence)
5	gaattcctcgacattgggagcagtcggctcgtgctcgacattgggagcagtcggctcgtgc-tcgacattgggagcagtcggctcgtgctcgagtctaga (B3 sequence)
6	SRp40
7	SELEX (=systematic evolution of ligands by expontential enrichment)/ in vitro splicing assay.
8	Tacke R, Manley, J. Sequence-specific RNA binding by an SR protein requires RS domain phosphorylation: creation of an SRp40-specific splicing enhancer. Proc Natl Acad Sci U S A. 1997 Feb 18; 94(4): 1148-1153.
9	PMID: 9037021; UID: 97188436.
10	B3 sequence used for minigene construction, contain 3 repeats of pH23; (tcgacattgggagcagtcggctcgtgc-pH23 selected by SELEX as high affinity binding site for phosphorylated HSRp40. Unphosphorylated SRp40 failed to select specific sequences.

1	exon 3
2	tat-rev gene of HIV-1
3	ID gi1145660
4	30 nt
5	gaagaagaaggtggagagagagagacagag
6	unknown
7	analysis of splicesome complex formation/ analysis of in vitro splicing of HIV-1 minigene substrates.
8	Amendt BA, Si ZH, Stoltzfus CM. Presence of exon splicing silencers within human immunodeficiency virus type 1 tat exon 2 and tat-rev exon 3: evidence for inhibition mediated by cellular factors. Mol Cell Biol. 1995 Nov; 15(11): 6480.
9	PMID: 7565800; UID: 96026028.
10	the same exon contains a splicing silencer