List of Splicing Silencers (980418)

1 location

2 gene

3 GenBank number (gi or accession)

4 size

5 sequence

6 binding factor(s)

7 experiments

8 citation

9 medline number

10 comments

1 exon 3

2 tat-rev gene of HIV-1

3 ID gi1145660

4 20 nt

5 agatccattcgattagtgaa

6 unknown

7 analysis of splicesome complex formation/ analysis of in vitro splicing of HIV-1 minigene substrates.

8 Amendt BA, Hesslein D, Chang LJ, Stoltzfus CM. Presence of exon splicing silencers within human immunodeficiency virus type 1 tat exon 2 and tat-rev exon 3: evidence for inhibition mediated by cellular factors. Mol Cell Biol. 1995 Nov; 15(11): 6480. No abstract available.

9 PMID: 7565800; UID: 96026028.

10 the same exon contains a splicing enhancer

1 EDA exon

2 human fibronectin

3 ID g31402

4 5 nt

5 caagg

6 unknown

7 analysis of a minigenes transiently transfected in HeLa cells by RT-PCR

8 Caputi M, Casari G, Guenzi S, Tagliabue R, Sidoli A, Melo CA, Baralle FE. A novel bipartite splicing enhancer modulates the differential processing of the human fibronectin EDA exon. Nucleic Acids Res. 1994 Mar 25; 22(6): 1018-1022.

9 PMID: 8152907; UID: 94203784.

10 this sequence (element B) lies within 81 nt bipartive splicing enhancer of EDA exon, that is essential for differential RNA processing; element A is positive modulator for recognition of the exon, its deletion results in constitutive exclusion of the EDA exon. Element B is a negative modulator for exon recognition, and its deletion results in constitutive inclusion of the EDA exon.

1 located 37 nt downstream of exon 6A and upstream of exon 6B

2 chicken b tropomyosin

3 ID g63835

4 33 nt

5 ccctctctctatcgctgtctcttgagccacgcc

6 not known

7 analysis of a minigenes in transient transfections by RT-PCR/ mutation analysis

8 Libri D, Piseri A, Fiszman MY. Tissue-specific splicing in vivo of the beta-tropomyosin gene: dependence on an RNA secondary structure. Science 1991 Jun 28;252(5014):1842-1845

9 PMID: 2063196, UID: 91289141

10 deletion or modification of this sequence (lying in intron IVS AB) induces the use of exon 6B in myoblasts; its retention inhibits the use of exon 6B. This intronic sequence are implicated in the formation of a stem loop structure with both sequences in exon 6B and sequence of intron IVS B7, immediately downstream of exon 6B.

1 exon K-SAM (IIIb)

2 human FGFR-2

3 ID gi232795

4 10 nt

5 tagggcaggc (contains most of the activity responsible for repressing K-SAM exon splicing in HeLa cells)

6 unknown

7 analysis of synthetic reportergenes in transient transfections by RT-PCR

8 Del Gatto F, Breathnach R. Exon and intron sequences, respectively, repress and activate splicing of a fibroblast growth factor receptor 2 alternative exon. Mol Cell Biol. 1995 Sep; 15(9): 4825-4834.

9 PMID: 7651400; UID: 95379826.

10 none

Last update: 18 April, 1998

nakai@imcb.osaka-u.ac.jp

1	location
2	gene
3	GenBank number (gi or accession)
4	size
5	sequence
6	binding factor(s)
7	experiments
8	citation
9	medline number
10	comments

1	exon 3
2	tat-rev gene of HIV-1
3	ID gi1145660
4	20 nt
5	agatccattcgattagtgaa
6	unknown
7	analysis of splicesome complex formation/ analysis of in vitro splicing of HIV-1 minigene substrates.
8	Amendt BA, Hesslein D, Chang LJ, Stoltzfus CM. Presence of exon splicing silencers within human immunodeficiency virus type 1 tat exon 2 and tat-rev exon 3: evidence for inhibition mediated by cellular factors. Mol Cell Biol. 1995 Nov; 15(11): 6480. No abstract available.
9	PMID: 7565800; UID: 96026028.
10	the same exon contains a splicing enhancer

1	EDA exon
2	human fibronectin
3	ID g31402
4	5 nt
5	caagg
6	unknown
7	analysis of a minigenes transiently transfected in HeLa cells by RT-PCR
8	Caputi M, Casari G, Guenzi S, Tagliabue R, Sidoli A, Melo CA, Baralle FE. A novel bipartite splicing enhancer modulates the differential processing of the human fibronectin EDA exon. Nucleic Acids Res. 1994 Mar 25; 22(6): 1018-1022.
9	PMID: 8152907; UID: 94203784.
10	this sequence (element B) lies within 81 nt bipartive splicing enhancer of EDA exon, that is essential for differential RNA processing; element A is positive modulator for recognition of the exon, its deletion results in constitutive exclusion of the EDA exon. Element B is a negative modulator for exon recognition, and its deletion results in constitutive inclusion of the EDA exon.

1	located 37 nt downstream of exon 6A and upstream of exon 6B
2	chicken b tropomyosin
3	ID g63835
4	33 nt
5	ccctctctctatcgctgtctcttgagccacgcc
6	not known
7	analysis of a minigenes in transient transfections by RT-PCR/ mutation analysis
8	Libri D, Piseri A, Fiszman MY. Tissue-specific splicing in vivo of the beta-tropomyosin gene: dependence on an RNA secondary structure. Science 1991 Jun 28;252(5014):1842-1845
9	PMID: 2063196, UID: 91289141
10	deletion or modification of this sequence (lying in intron IVS AB) induces the use of exon 6B in myoblasts; its retention inhibits the use of exon 6B. This intronic sequence are implicated in the formation of a stem loop structure with both sequences in exon 6B and sequence of intron IVS B7, immediately downstream of exon 6B.

1	exon K-SAM (IIIb)
2	human FGFR-2
3	ID gi232795
4	10 nt
5	tagggcaggc (contains most of the activity responsible for repressing K-SAM exon splicing in HeLa cells)
6	unknown
7	analysis of synthetic reportergenes in transient transfections by RT-PCR
8	Del Gatto F, Breathnach R. Exon and intron sequences, respectively, repress and activate splicing of a fibroblast growth factor receptor 2 alternative exon. Mol Cell Biol. 1995 Sep; 15(9): 4825-4834.
9	PMID: 7651400; UID: 95379826.
10	none