List of Splicing Silencers (980418)

1location
2gene
3GenBank number (gi or accession)
4size
5sequence
6binding factor(s)
7experiments
8citation
9medline number
10comments

1exon 3
2tat-rev gene of HIV-1
3ID gi1145660
420 nt
5agatccattcgattagtgaa
6unknown
7analysis of splicesome complex formation/ analysis of in vitro splicing of HIV-1 minigene substrates.
8Amendt BA, Hesslein D, Chang LJ, Stoltzfus CM. Presence of exon splicing silencers within human immunodeficiency virus type 1 tat exon 2 and tat-rev exon 3: evidence for inhibition mediated by cellular factors. Mol Cell Biol. 1995 Nov; 15(11): 6480. No abstract available.
9PMID: 7565800; UID: 96026028.
10the same exon contains a splicing enhancer

1EDA exon
2human fibronectin
3ID g31402
45 nt
5caagg
6unknown
7analysis of a minigenes transiently transfected in HeLa cells by RT-PCR
8Caputi M, Casari G, Guenzi S, Tagliabue R, Sidoli A, Melo CA, Baralle FE. A novel bipartite splicing enhancer modulates the differential processing of the human fibronectin EDA exon. Nucleic Acids Res. 1994 Mar 25; 22(6): 1018-1022.
9PMID: 8152907; UID: 94203784.
10this sequence (element B) lies within 81 nt bipartive splicing enhancer of EDA exon, that is essential for differential RNA processing; element A is positive modulator for recognition of the exon, its deletion results in constitutive exclusion of the EDA exon. Element B is a negative modulator for exon recognition, and its deletion results in constitutive inclusion of the EDA exon.

1located 37 nt downstream of exon 6A and upstream of exon 6B
2chicken b tropomyosin
3ID g63835
433 nt
5ccctctctctatcgctgtctcttgagccacgcc
6not known
7analysis of a minigenes in transient transfections by RT-PCR/ mutation analysis
8Libri D, Piseri A, Fiszman MY. Tissue-specific splicing in vivo of the beta-tropomyosin gene: dependence on an RNA secondary structure. Science 1991 Jun 28;252(5014):1842-1845
9PMID: 2063196, UID: 91289141
10deletion or modification of this sequence (lying in intron IVS AB) induces the use of exon 6B in myoblasts; its retention inhibits the use of exon 6B. This intronic sequence are implicated in the formation of a stem loop structure with both sequences in exon 6B and sequence of intron IVS B7, immediately downstream of exon 6B.

1exon K-SAM (IIIb)
2human FGFR-2
3ID gi232795
410 nt
5tagggcaggc (contains most of the activity responsible for repressing K-SAM exon splicing in HeLa cells)
6unknown
7analysis of synthetic reportergenes in transient transfections by RT-PCR
8Del Gatto F, Breathnach R. Exon and intron sequences, respectively, repress and activate splicing of a fibroblast growth factor receptor 2 alternative exon. Mol Cell Biol. 1995 Sep; 15(9): 4825-4834.
9PMID: 7651400; UID: 95379826.
10none


Last update: 18 April, 1998
nakai@imcb.osaka-u.ac.jp